REMIND -I encourage you to sign up for text/email reminders via Remind.
My "sign in" page for AP Biology 2014-15 https://www.remind.com/join/drgapbio14 - enter your phone number.
OR- Either text @drgapbio14 to 81010 or email drgapbio14@mail.remind.com
(You can sign up for both sms-texts and email.) Please sign up with your real name if it asks... Standard text rates apply. If you use the email option you can leave the subject and body of the message blank.
Votes: Dark-32, Anatomy-31, Bergeron-15, Art-14
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; |
Agenda and Homework updated 5/15
5/18 The rest of the year….plans; Debrief/FRQs; germinate dwarf poinciana
5/20 Serial Dilution Lab
5/22 Anatomy Video ?
Study Survey- In order to better utilize time and
resources in the future I want to do an honest analysis of how you studied for
the exam. To that end I have prepared a Study Feeback survey. I've tried to ask
relevant questions, but, if you have feedback you can give me, that you think
will be helpful, there are some open ended question fields. Feel free to
elaborate on your study experience.
While the form asks for your ID number (so I can give you credit for doing it)
you will not be graded based on how you answer, and I will actually strip the
ID numbers from the file before I read anything or process the data. To
get credit for submitting the survey it has to be completed before 5/22 - 11:59
PM
Actual link: http://mdgottfried.net/Forms/AP/StudyFeedback-2015.html
Shorter link (if you are typing it in a phone): http://mdgottfried.net/sf.html
Homework
Due 5/22 Optional - Extra Credit - Study Feedback Survey
Due 5/26:
Optional-Serial Dilution Lab (not extra credit-an extra grade)
|
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; |
Agenda and Homework updated 5/8
I will not take late work at for things due before May 9,
after May 11 (no point in preparing for the AP exam after the exam!)
AP EXAM 5/11
5/12 Debrief (think about what was on the test and
what you
did to prepare for the exam)-There will be an assignment related to
this - I will be proctoring during 2nd and 4th periods. I don't
know where they will send you.
5/14 Debrief (think about what was on the test and
what you
did to prepare for the exam)-There will be an assignment related to
this - I will be proctoring during 2nd and 4th periods. I don't
know where they will send you.
5/18 The rest of the year….plans; Debrief/FRQs; germinate dwarf poinciana
5/20 Serial Dilution Lab
5/22 Anatomy Video ?
Homework
Due 5/22 Optional - Extra Credit - Study Feedback Survey
Due 5/26:
Optional-Serial Dilution Lab
The large
vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
A different
large vocabulary file:
https://quizlet.com/23241611/scatter
Life
advice-The first year the school opened I had “office hours” for my AP Bio
students on the weekends at FIU. 100% of the students showed up. This year, I
have made myself available for “office hours” on 12 different dates, and have
had 9 students show up. That is 8th-12th graders. Hmmm.
After the
exams - possibilities: Equality/Equity -Harrison
Bergeron; Dr. Tatiana's Sex Guide to
All Creation; Dr. Gunter Van Hagen's Anatomy -Autopsy video Think about what you want and we'll discuss it on the 18th.
Agenda and Homework updated 4/24
I will not take late work at for things due before May 9,
after May 11 (no point in preparing for the AP exam after the exam!)
4/28 2014 MC exam
4/30 (ER) Review of 2014 MC Exam
AP week 1 – Review – on your own w/explanations as needed
AP EXAM 5/11
Homework
The large
vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
A different large
vocabulary file:
https://quizlet.com/23241611/scatter
I am
available for after school help in preparing for the AP Exam on the following
dates: Thurs. Wed 4/29, 5/6 and Saturday
5/9 10 AM-? at Panera’s at 125th street. I will also be available to
the honors students after school on some Monday afternoons from 2:20-4:00 PM to
answer questions and/or help them prepare for the EOC. (4/27, 5/4) If AP needs
something and can “play well” with them, you are welcome with your questions
then too.
Review
Homework:
Dynamic Study
Modules (about 20-25 MC questions set up by the publisher in an interactive
tutorial format so you will remember the content-each should take about 30
minutes)
I have
assigned them in batches from now until May 1. They are all available now and
for most chapters there is actually a second set of questions that I haven’t
assigned, but, that are available under the heading of “test your knowledge”. I
don’t know exactly what your interface looks like, so I can’t be more specific.
If you submit
them after the due date “Mastering” does not give me a score. I can “recover”
your score with some effort, so, if you tell me you did a Dynamic Study Module
late, I will look for the grade but take off significant points for making me
do extra work!
due 4/20 –
11:59 PM Chapter 14, 15, 16, 17, 18, 19, 20 (This the biggest batch in the
shortest time…but it is over a weekend)
due 4/24 –
11:59 PM Chapter 21, 22, 23, 24, 25
due 4/27
-11:59 PM Chapter 40, 43, 48
due 4/30 –
11:59 PM Chapter 51, 52, 53, 54, 55, 56
due 5/4 –
11:59 PM Non-Dynamic Study Module Assorted Questions
Review
Homework FRQ:
Due 4/28 LAB:
Time to sink w/expanded conclusions
Due 4/28
Images packet; Essential Knowledge Diagnostic
FYI: Barry SSRP
(10 students, college lab, research); Rising 10th & 11th
graders; 3.0 unweighted GPA; preference to economically disadvantaged
Agenda and Homework updated 4/16
I will not take late work at for things due before May 9,
after May 11 (no point in preparing for the AP exam after the exam!)
4/20 MC Review; Images packet; Essential Knowledge
Diagnostic (these packets will be passed out in class 4/20, but are already
available in the shared folder)
4/22 pre-bubbling; MC- Review; images packet; Essential
Knowledge Diagnostic
4/24 Images packet, Essential Knowledge Diagnostic/LAB
Review; Energetics: Time to sink
4/28 2014 MC exam
4/30 (ER) Review of 2014 MC Exam
AP week 1 – Review – on your own w/explanations as needed
AP EXAM 5/11
Homework
The large
vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
I am
available for after school help in preparing for the AP Exam on the following
dates: Thurs. Wed 4/22. 4/29, 5/6 and
Saturday 5/9 10 AM-? at Panera’s at 125th street. I will also be
available to the honors students after school on some Monday afternoons from
2:20-4:00 PM to answer questions and/or help them prepare for the EOC. (4/20,
4/27, 5/4) If AP needs something and can “play well” with them, you are welcome
with your questions then too.
Review
Homework:
Dynamic Study
Modules (about 20-25 MC questions set up by the publisher in an interactive
tutorial format so you will remember the content-each should take about 30
minutes)
I have
assigned them in batches from now until May 1. They are all available now and
for most chapters there is actually a second set of questions that I haven’t
assigned, but, that are available under the heading of “test your knowledge”. I
don’t know exactly what your interface looks like, so I can’t be more specific.
If you submit
them after the due date “Mastering” does not give me a score. I can “recover”
your score with some effort, so, if you tell me you did a Dynamic Study Module
late, I will look for the grade but take off significant points for making me
do extra work!
due 4/20 –
11:59 PM Chapter 14, 15, 16, 17, 18, 19, 20 (This the biggest batch in the
shortest time…but it is over a weekend)
due 4/24 –
11:59 PM Chapter 21, 22, 23, 24, 25
due 4/27
-11:59 PM Chapter 40, 43, 48
due 4/30 –
11:59 PM Chapter 51, 52, 53, 54, 55, 56
due 5/4 –
11:59 PM Non-Dynamic Study Module Assorted Questions
Review
Homework FRQ:
Due 4/20 –
from the Massssive packet # 33 & 52
Due 4/28 LAB:
Time to sink w/expanded conclusions
Due 4/28
Images packet; Essential Knowledge Diagnostic
FYI-Schedule Until further notice, if the date is odd,
it is block 1-3-5, if the date is even, it is block 2-4-6 |
I will not take late work at for things due before May 9,
after May 11 (no point in preparing for the AP exam after the exam!)
4/14 Class
time will mostly be review of MC questions and FRQ writing and review
4/16 Practice
AP MC section
There will be “sections” of old AP tests used as class
assignments and as practice tests. BE PREPARED!
The large vocabulary
file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
Review
Homework:
Dynamic Study
Modules (about 20-25 MC questions set up by the publisher in an interactive
tutorial format so you will remember the content-each should take about 30
minutes)
I have
assigned them in batches from now until May 1. They are all available now and
for most chapters there is actually a second set of questions that I haven’t
assigned, but, that are available under the heading of “test your knowledge”. I
don’t know exactly what your interface looks like, so I can’t be more specific.
due 4/10 –
11:59 PM Chapter 3, 4, 5
due 4/14 –
11:59 PM Chapter 6, 7, 8, 9
due 4/17 -
11:59 PM Chapter 10, 11, 12, 13
due 4/20 –
11:59 PM Chapter 14, 15, 16, 17, 18, 19, 20 (This the biggest batch in the
shortest time…but it is over a weekend)
due 4/24 –
11:59 PM Chapter 21, 22, 23, 24, 25
due 4/27
-11:59 PM Chapter 40, 43, 48
due 4/30 –
11:59 PM Chapter 51, 52, 53, 54, 55, 56
due 5/4 –
11:59 PM Non-Dynamic Study Module Assorted Questions
Review
Homework FRQ:
Due 4/14 –
from the Massssive packet # 28 & 29
Due 4/20 –
from the Massssive packet # 33 & 52
AP® students will get their scores online in July. To access their scores online, students must follow the steps outlined below. Please
share these steps with your students, particularly those who have never taken
an AP Exam before.
Score
Release Schedule |
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; |
Agenda and Homework updated 4/3
I will not take late work at for things due before May 9,
after May 11 (no point in preparing for the AP exam after the exam!)
4/6, 8, 10
Class time will mostly be review of MC questions and FRQ writing and review
There will be “sections” of old AP tests used as class
assignments and as practice tests. BE PREPARED!
Homework
The time has
come… Overall studying – Start with the large vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
What I would
do, mostly because it amuses me, would be the Scatter game. While I did it, I
would make a list of those terms I didn’t recognize or know, and then I would
look each of those up.
Open
Book/Homework FRQs-Due 4/6 (Look these up, so you learn!):
In the
life cycles of a fern and a flowering plant, compare and contrast each of the
following:
Describe the differences between the terms in
each of the following pairs.
Starting
after break I will be available for after school help in preparing for the AP
Exam on the following dates: Thurs. 4/9, 4/16, Wed 4/22. 4/29, 5/6 and Saturday
5/9 10 AM-? at Panera’s at 125th street. Starting 3/30 I will also
be available to the honors students after school on some Monday afternoons from
2:20-4:00 PM to answer questions and/or help them prepare for the EOC. (4/6,
4/20, 4/27, 5/4) If AP needs something and can “play well” with them, you are
welcome with your questions then too.
Review
Homework:
Dynamic Study
Modules (about 20-25 MC questions set up by the publisher in an interactive
tutorial format so you will remember the content-each should take about 30 minutes)
I have
assigned them in batches from now until May 1. They are all available now and
for most chapters there is actually a second set of questions that I haven’t
assigned, but, that are available under the heading of “test your knowledge”. I
don’t know exactly what your interface looks like, so I can’t be more specific.
due 4/10 –
11:59 PM Chapter 3, 4, 5
due 4/14 –
11:59 PM Chapter 6, 7, 8, 9
due 4/17 -
11:59 PM Chapter 10, 11, 12, 13
due 4/20 –
11:59 PM Chapter 14, 15, 16, 17, 18, 19, 20 (This the biggest batch in the
shortest time…but it is over a weekend)
due 4/24 –
11:59 PM Chapter 21, 22, 23, 24, 25
due 4/27
-11:59 PM Chapter 40, 43, 48
due 4/30 –
11:59 PM Chapter 51, 52, 53, 54, 55, 56
due 5/4 –
11:59 PM Non-Dynamic Study Module Assorted Questions
Review
Homework FRQ:
Due 4/14 –
from the Massssive packet # 28 & 29
Names-If you
don’t put your name on an online form (this happens more often than you would
think), there is nothing you or I can do to give you the grade. You either have
to re-do the assignment for a late grade, or take the “Z..” We can’t match “handwriting” on the forms
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; EXCEPT 4/1-even, 4/2-odd |
Check your grades. There are too many zeros for the
assignments due just before break. FIX this ASAP. I will not take late work at for things due
before May 9, after May 11 (no point in preparing for the AP exam after the
exam!)
3/30 EXAM -Ecology
4/2 Finish Animal Behavior; The “plan”
Homework
Due 3/29
(11:59 PM) Mastering Biology 26- Ecology (LONG-Multichapter, multigrade 3
hours)
NB: There
will be an exam on Ecology (CH 52, 53, 54, 55) on 3/30 (first day back from
break) 75 questions – MC
The time has
come… Overall studying – Start with the large vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
What I would
do, mostly because it amuses me, would be the Scatter game. While I did it, I
would make a list of those terms I didn’t recognize or know, and then I would
look each of those up.
Open
Book/Homework FRQs-Due 4/6 (Look these up, so you learn!):
In the
life cycles of a fern and a flowering plant, compare and contrast each of the
following:
Describe the differences between the terms in
each of the following pairs.
Starting
after break I will be available for after school help in preparing for the AP
Exam on the following dates: Wed 4/1. Thurs. 4/9, 4/16, Wed 4/22. 4/29, 5/6 and
Saturday 5/9 10 AM-? at Panera’s at 125th street. Starting 3/30 I
will also be available to the honors students after school on some Monday
afternoons from 2:20-4:00 PM to answer questions and/or help them prepare for
the EOC. (3/30, 4/6, 4/20, 4/27, 5/4) If AP needs something and can “play well”
with them, you are welcome with your questions then too.
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; EXCEPT 4/1-even, 4/2-odd |
Agenda and Homework updated 3/13
3/16 Neurons
3/18 Neuron
Competition in the hall; Animal Behavior
3/30 EXAM -Ecology
4/2 Finish Animal Behavior; The “plan”
Homework
Everything
due after 3/13 will go into the 4th marking period
Due 3/15
(11:59 PM) Mastering Biology 24-Neurons (hour)
Due 3/16 (4th
marking period) Tree thinking- Prepare an outline (can work in pairs) on the
key points of the article; You can do a mind-map or other graphic presentation,
but, you need to be comprehensive, covering all the misconceptions that are
discussed in the article.
Due 3/17
(11:59 PM) Mastering Biology 25-Animal Behavior (30 min)
Due 3/29
(11:59 PM) Mastering Biology 26- Ecology (LONG-Multichapter, multigrade 3
hours)
NB: I’m
setting up the MB to be mostly Activities, Tutorials, Videos with fewer MC
questions.
NB: There
will be an exam on Ecology (CH 52, 53, 54, 55) on 3/30 (first day back from
break) 75 questions – MC
The time has
come… Overall studying – Start with the large vocabulary file:
http://quizlet.com/22315269/ultimate-ap-biology-vocabulary-review-flash-cards/
What I would
do, mostly because it amuses me, would be the Scatter game. While I did it, I
would make a list of those terms I didn’t recognize or know, and then I would
look each of those up.
OFFICE HOURS: | ||
Starting
after break I will be available for after school help in preparing for the AP
Exam on the following dates: Wed 4/1. Thurs. 4/9, 4/16, Wed 4/22. 4/29, 5/6 and
Saturday 5/9 10 AM-? at Panera’s at 125th street. Starting 3/30 I will also be available to the honors students after school on some Monday afternoons from 2:20-4:00 PM to answer questions and/or help them prepare for the EOC. (3/30, 4/6, 4/20, 4/27, 5/4) If AP needs something and can “play well” with them, you are welcome with your questions then too. | ||
Debrief-Sunny
Isles – if you participated in the 3/12 event at Sunny Isles find a minute or
two to talk to me about how the “little ones” responded to your activity (this
is to help planning for next year).
Agenda and Homework updated 3/6
3/10 Immune System
3/12 Genetic Technology
and Society Discussion/Debates
3/16 Neurons
3/18 Animal Behavior
Homework
Due 3/9-11:59
PM: Mastering Biology 23-Immune System (60 min)
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day
(see handout or the file in the shared folder)Add to Soundbite debates:
Should it be legal to create embryos out of 3 parents (to cure mitochondrial
disease)? See the debate in Great Britain recently!
3/12-Extra
Credit- Mad Science (“Sunny Isles Science With A Twist”) event – 5:30-7:00 (+
setup and cleanup time); PLUS time after school to “learn” your station(s)
Everything
due after 3/13 will go into the 4th marking period
Due 3/15
(11:59 PM) Mastering Biology 24-Neurons (hour)
Due 3/16 (4th
marking period) Tree thinking- Prepare an outline (can work in pairs) on the
key points of the article; You can do a mind-map or other graphic presentation,
but, you need to be comprehensive, covering all the misconceptions that are
discussed in the article.
Due 3/17
(11:59 PM) Mastering Biology 25-Animal Behavior (30 min)
Due 3/29
(11:59 PM) Mastering Biology 26- Ecology (LONG-Multichapter, multigrade 3
hours)
NB: I’m
setting up the MB to be mostly
Activities, Tutorials, Videos with fewer MC questions.
NB: There
will be an exam on Ecology (CH 52, 53, 54, 55) on 3/30 (first day back from
break) 75 questions - MC
DTRA -2015 Joint Science Technology Institute (JSTI)
Summer Opportunity - APPLICATION NOW OPEN The Joint Science Technology Institute (JSTI) will be
held July 18-31, 2015 in Aberdeen, Md. Students should apply via the only application link at http://www.orau.org/center-for-science-education/events/jsti/default.html Application deadline is March 15, 2015. BACKGROUND: The Defense Threat Reduction Agency's Joint
Science and Technology Office (DTRA-JSTO) partnered with the U.S. Army
Edgewood Chemical Biological Center (ECBC), the U.S. Army Public Health
Command, the U.S. Naval Research Laboratory and the U.S. Army Criminal
Investigation Laboratory to launch the JSTI. JSTI is a two-week all expenses
paid, residential program, administered by Oak Ridge Associated Universities
, affording 36 high school students from across the country the opportunity
to work on leading-edge science, technology, engineering and math (STEM)
projects with Department of Defense scientists and engineers. The purpose of
the program is to expose students to scientific research through hands-on
projects, to enable students to work with real-world scientists, and to
increase students' awareness of STEM career opportunities. Student projects
include work in areas such as: Robotics, Water Analysis (Wet Chemistry), Forensics
Analysis, Bacteria Resistant Surfaces, Operational Research Analysis, and 3D
printing. Students conduct their science and engineering projects at ECBC's
and Harford Community College's research laboratories. Eligibility for students: ·
Student must be 16 by July 17, 2015 ·
Student must be a U.S. citizen ·
Student must be a high school student in the
2015-2016 school year *Student must have a teacher recommendation *Student
must be willing to work cooperatively in a group and follow instructions |
FYI-Schedule Until
further notice, if the date is odd, it is block 1-3-5, if the date is even,
it is block 2-4-6; EXCEPT 4/1-even, 4/2-odd |
3/2 Animal Form and Function
3/4 Animal Form and
Function; Plant germination & light/colors?
3/6 Immune System; Tree
Reading (BYOD)
(You will be reading a
rather long article on tree reading from the internet…if you have time or want
to, you can get started, it is linked above).
No lectures on this stuff. We will try a variety of other
methods of going over this material.
We are starting with Chapter 40 & 43, and on Friday a
review of reading phylogenetic trees (cladograms)
For the cladogram activity an internet capable device, with
a larger than phone screen would be useful –BYOD-(1/2-3 students)
Homework
Due 3/6: FRQ-
The following data were
collected by observing subcellular structures of three different types of eukaryotic cells.
Due 3/5-11:59PM:
Mastering Biology 22-Animal Form and Function (30 min)
Due 3/9-11:59
PM: Mastering Biology 23-Immune System (60 min)
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day
(see handout or the file in the shared folder)
Add to
Soundbite debates: Should it be legal to create embryos out of 3 parents (to
cure mitochondrial disease)? See the debate in Great Britain recently!
3/12-Extra
Credit- Mad Science (“Sunny Isles Science With A Twist”) event – 5:30-7:00 (+
setup and cleanup time); PLUS time after school to “learn” your station(s);
Learn YOUR assigned station(s) any 2nd lunch this week OR any
afternoon after school except Tuesday.
FYI – Gattaca
tomorrow (3/3) if you want to come see it period 1, 3 or 5 AND get a pass from
your teacher AND are willing to sit on a stool if there aren’t enough seats, show
up tomorrow (3/3) with the pass.
Weird
Request-I want (for a new lab I am cooking up) a lot (really-a lot) of film
canister-like containers. The vials that diabetic test strips come in are
probably the best, most easily available items, that meet my needs. If you can
collect these and turn them in you will be rewarded (container=candy).
FYI-Schedule Mon,
Tues, Fri-1,2,3,4,5,6, Wed-1,3,5 Thur-2, 4, 6 on 2/9 for the rest of February |
Agenda and Homework updated 2/21
2/23 Signals; Cell-Cell
Communication
2/24 Signals Examples
2/26 Re-try: plant
germination in the dark w/colors?;
2/27 EXAM (3 FRQ type
questions) on chapter “11” (includes a χ2 problem)
Homework
AP Extra
Credit-By 2/23 Watch the 2007 Ghost in Your Genes (PBS-NOVA) and write (other
modalities will be considered) a comparison review of it and the one you
watched in class (2011 Ghost in your Genes BBC-Horizon; if you didn’t watch it
in class, its link is above)https://www.youtube.com/watch?v=f4LGZlHSAQY
Due 2/24 Read
CellCellCommunications from Biology In Focus-OnLine (It is in the shared folder-you will have to rotate
even numbered pages-sorry)
Due 2/26 (midnight)
Mastering Biology 21- on Chapter 11 (about 40 minutes)
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day (see handout or the file in the shared folder)
Add to
Soundbite debates: Should it be legal to create embryos out of 3 parents (to
cure mitochondrial disease)? See the debate in Great Britain recently!
3/12-Extra
Credit- Mad Science (“Sunny Isles Science With A Twist”) event – 5:30-7:00 (+ setup
and cleanup time); PLUS time after school to “learn” your station(s)
FYI-Schedule Mon,
Tues, Fri-1,2,3,4,5,6, Wed-1,3,5 Thur-2, 4, 6 on 2/9 for the rest of February |
Agenda and Homework updated 2/13
2/19 Review Assignments; Review tests
– a step back -
2/20 Viruses (chapter 19)
Homework
Due to a combination of
factors a lot of stuff will be due on 2/19
Do not wait until 2/18.
Pace yourself
Due 2/19 Questions raised
by the video, Ghost in Your Genes. Grade will be based on the quality as well
as quantity of your questions AND their relation to the video-Given that the
video is from 2011, any research to answer the questions will be rewarded with
a higher grade. NOTE: There is extra credit related to this farther down in the
web page. Eukaryotic genetic control; The Ghost in your Genes: http://documentaries-plus.blogspot.com/2011/12/ghost-in-your-genes.html if you are absent 2/13
(If that link doesn’t work, try: https://www.youtube.com/watch?v=fMxgkSgZoJs)
AP Extra
Credit-By 2/23 Watch the 2007 Ghost in Your Genes (PBS-NOVA) and write (other
modalities will be considered) a comparison review of it and the one you
watched in class (2011 Ghost in your Genes BBC-Horizon; if you didn’t watch it
in class, its link is above)https://www.youtube.com/watch?v=f4LGZlHSAQY
Due 2/19 DNA-Tech
Forms (ALL 6 of them!) you can work in small groups 1-3, but, each of you is responsible
for ALL the answers. I STRONGLY suggest you work together, not distribute the
work.
DNATech-I http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormI-2014.html
DNATech-II http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormII-2014.html
DNATech-III http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIII-2014.html
DNATech-IV http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIV-2014.html.
DNATech-V http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormV-2014.html
DNATech-VI http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormVI-2014.html
Due 2/19 BLAST LAB
https://drive.google.com/file/d/0B0r2l9_tFA_FWUctT0hpS3E5LXc/view?usp=sharing
For ease of
“cutting/pasting” the 5 DNA sequences will also be here:
A |
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA |
B |
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT |
C |
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT |
D |
attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtcaccaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaaggatttctacatagtggaacccctggcatttgaag |
E |
ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG |
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day (see handout or the file in the shared folder)
Add to Soundbite
debates: Should it be legal to create embryos out of 3 parents (to cure
mitochondrial disease)? See the debate in Great Britain recently!
Questbridge
2015-Colleg Prep Scholarship program for academically motivated low-income
high school juniors. www.questbridge.org/outreach-materials I can refer you…. |
FYI-Schedule Mon,
Tues, Fri-1,2,3,4,5,6, Wed-1,3,5 Thur-2, 4, 6 on 2/9 for the rest of February |
Agenda and Homework updated 2/6
2/9 Gene Control – Finish Prokaryotes/
start Eukaryotes
2/10 Finish Gene Control Eukaryotes
2/12 EXAM 15, 16, 17, 18
2/13 Ghost in Your Genes (Video);
Epigenetics discussion
Eukaryotic genetic
control; The Ghost in your Genes: http://documentaries-plus.blogspot.com/2011/12/ghost-in-your-genes.html if you are absent 2/13
Homework
Due 2/12 (11:59 PM)
Mastering 19-Chapter 20 – Biotechnology (less than 1 hour)
Due to a combination of
factors a lot of stuff will be due on 2/19
Do not wait until 2/18.
Pace yourself
Due 2/19 Questions raised
by the video, Ghost in Your Genes. Grade will be based on the quality as well
as quantity of your questions AND their relation to the video-Given that the
video is from 2007, any research to answer the questions will be rewarded with
a higher grade.
Due 2/19 DNA-Tech
Forms (ALL 6 of them!) you can work in small groups 1-3, but, each of you is responsible
for ALL the answers. I STRONGLY suggest you work together, not distribute the
work.
DNATech-I http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormI-2014.html
DNATech-II http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormII-2014.html
DNATech-III http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIII-2014.html
DNATech-IV http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIV-2014.html.
DNATech-V http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormV-2014.html
DNATech-VI http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormVI-2014.html
Due 2/19 BLAST LAB
https://drive.google.com/file/d/0B0r2l9_tFA_FWUctT0hpS3E5LXc/view?usp=sharing
For ease of
“cutting/pasting” the 5 DNA sequences will also be here:
A |
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA |
B |
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT |
C |
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT |
D |
attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtcaccaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaaggatttctacatagtggaacccctggcatttgaag |
E |
ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG |
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day (see handout or the file in the shared folder)
Add to Soundbite
debates: Should it be legal to create embryos out of 3 parents (to cure
mitochondrial disease)? See the debate in Great Britain recently!
Questbridge
2015-Colleg Prep Scholarship program for academically motivated low-income high
school juniors.
www.questbridge.org/outreach-materials
I can refer
you….
FYI-Schedule 2/2 1-3-5 2/3 2-4-6 (senior panoramic picture) 2/4 1-3-5 2/5 2-4-6 (senior breakfast/early
release) 2/6 1-3-5 |
Agenda and Homework updated 1/30
2/3 OnLine – DNA Tech/Genetic
Control/BLAST
2/5 (early release) OnLine – DNA
Tech/Genetic Control/BLAST
2/9 Gene Control – Finish Prokaryotes/
start Eukaryotes
2/10 Finish Gene Control Eukaryotes
2/12 EXAM 15, 16, 17, 18
2/13 Ghost in Your Genes (Video);
Epigenetics discussion
Eukaryotic genetic
control; The Ghost in your Genes: http://documentaries-plus.blogspot.com/2011/12/ghost-in-your-genes.html if you are absent 2/13
Homework
Due 2/3
Finish Chi Square problems from the handout (A copy of the handout is available
in the shared folder)
Due 2/12 (11:59 PM)
Mastering 19-Chapter 20 – Biotechnology (less than 1 hour)
Due to a combination of
factors a lot of stuff will be due on 2/19
Do not wait until 2/18. Pace
yourself
Due 2/19 Questions raised
by the video, Ghost in Your Genes. Grade will be based on the quality as well
as quantity of your questions AND their relation to the video-Given that the
video is from 2007, any research to answer the questions will be rewarded with
a higher grade.
Due 2/19 DNA-Tech
Forms (ALL 6 of them!) you can work in small groups 1-3, but, each of you is responsible
for ALL the answers. I STRONGLY suggest you work together, not distribute the
work.
DNATech-I http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormI-2014.html
DNATech-II http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormII-2014.html
DNATech-III http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIII-2014.html
DNATech-IV http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIV-2014.html.
DNATech-V http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormV-2014.html
DNATech-VI http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormVI-2014.html
Due 2/19 BLAST LAB
https://drive.google.com/file/d/0B0r2l9_tFA_FWUctT0hpS3E5LXc/view?usp=sharing
For ease of
“cutting/pasting” the 5 DNA sequences will also be here:
A |
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA |
B |
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT |
C |
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT |
D |
attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtcaccaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaaggatttctacatagtggaacccctggcatttgaag |
E |
ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG |
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day (see handout or the file in the shared folder)
FYI-Schedule 2/2 1-3-5 2/3 2-4-6 (senior panoramic picture) 2/4 1-3-5 2/5 2-4-6 (senior breakfast/early
release) 2/6 1-3-5 |
Agenda and Homework updated 1/28
2/3 OnLine – DNA Tech/Genetic
Control/BLAST
2/5 (early release) OnLine – DNA Tech/Genetic
Control/BLAST
2/9 Gene Control - Eukaryotes
2/10 Review
2/12 EXAM 15, 16, 17, 18
I will set the tests up as 30 minutes
–review (you can ask questions, but, I’m not leading a review), 60 minutes test
(50 min test 10 min data entry), 30 minutes new lecture material
2/13 Ghost in Your Genes (Video);
Epigenetics discussion
Eukaryotic genetic
control; The Ghost in your Genes: http://documentaries-plus.blogspot.com/2011/12/ghost-in-your-genes.html if you are absent 2/13
Videos to watch-
Molecular Biology https://www.youtube.com/watch?v=yYIZgS-L5Sc
Operon https://www.youtube.com/watch?v=XQV-OXr1rPU
Lac operon https://www.youtube.com/watch?v=10YWgqmAEsQ
Lac Operon (MIT) https://www.youtube.com/watch?v=2TL8rY9Rc_A
Gene Regulation https://www.youtube.com/watch?v=3S3ZOmleAj0
College Level-50
minute lecture on eukaryotic genome control
https://www.youtube.com/watch?v=-08M23Lcs10
Homework
Due 2/3
Finish Chi Square problems from the handout
Due to a combination of
factors a lot of stuff will be due on 2/19
Do not wait until 2/18.
Pace yourself
Due 2/19 Questions raised
by the video, Ghost in Your Genes. Grade will be based on the quality as well
as quantity of your questions AND their relation to the video-Given that the
video is from 2007, any research to answer the questions will be rewarded with
a higher grade.
Due 2/19 DNA-Tech
Forms (ALL 6 of them!) you can work in small groups 1-3, but, each of you is responsible for
ALL the answers. I STRONGLY suggest you work together, not distribute the work.
DNATech-I http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormI-2014.html
DNATech-II http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormII-2014.html
DNATech-III http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIII-2014.html
DNATech-IV http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormIV-2014.html.
DNATech-V http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormV-2014.html
DNATech-VI http://mdgottfried.cwahi.net/Forms/AP/DNATech/DNATechFormVI-2014.html
Due 2/19 BLAST LAB
https://drive.google.com/file/d/0B0r2l9_tFA_FWUctT0hpS3E5LXc/view?usp=sharing
For ease of “cutting/pasting”
the 5 DNA sequences will also be here:
A |
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA |
B |
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT |
C |
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT |
D |
attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtcaccaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaaggatttctacatagtggaacccctggcatttgaag |
E |
ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG |
Soundbite debates:
Due 3/12 (depending on block scheduling) Research and prepare “sound bites” for
the DNA Technology Discussion Day (see
handout or the file in the shared folder)
FYI-Schedule
1/26-2-4-6
1/27 1-3-5
1/28 2-4-6
1/29 1-3-5
1/30 2-4-6
Agenda and Homework updated 1/23
1/26 Translation; Gene Regulation
1/28 EXAM 12, 13, 14; Gene Regulation
1/30 Gene Regulation; Review
2/3 EXAM 15, 16, 17, 18
2/5 (early release) Go over EXAMS
& HW FRQs
I will set the tests up as 30 minutes
–review (you can ask questions, but, I’m not leading a review), 60 minutes test
(50 min test 10 min data entry), 30 minutes new lecture material
Homework
DATE CHANGE Due
1/26 (I don’t have AP BIO on 1/23-so I’m giving you an extra weekend) Fruit Fly
Simulation (Can be/should be done in pairs/threes – no groups of 4 or larger)
It is a LONG assignment and requires
thought to do well-
https://drive.google.com/file/d/0B0r2l9_tFA_FWnd6YkRyWTM2d3M/view?usp=sharing
Virtual Fly
Site: http://www.sciencecourseware.org/vcise/drosophila/
Due 1/26 FRQ: An organism is heterozygous at two genetic
loci on different chromosomes.
| |
| |
| |
--| --|
| |
| |
--| --|
| |
a)
Explain how these alleles are transmitted by the process of mitosis to
daughter cells.
b)
Explain how these alleles are distributed by the process of meiosis to
gametes.
c)
Explain how the behavior of these two pairs of homologous chromosomes
during meiosis provides the physical basis for Mendel's two laws of
inheritance.
Labeled diagrams that are explained in
your answer may be useful.
Due 1/28 FRQ: Experiments
by the following scientists provided critical information concerning DNA.
Describe each classical experiment and indicate how it provided evidence for
the chemical nature of the gene.
a. Hershey and Chase - bacteriophage replication
b. Griffith and Avery - bacterial transformation
c. Meselson and Stahl - DNA replication in
bacteria
Due 2/3
Finish Chi Square problems from the handout
Soundbite
debates: Due 3/12 (depending on block scheduling) Research and prepare “sound
bites” for the DNA Technology Discussion Day (see handout or the file in the shared folder)
FYI-Schedule
1/20-2-4-6
1/21 1-3-5
1/22 2-4-6
1/23 1-3-5
Agenda and Homework updated 1/16
1/20 Finish DNA Replication; Central
Dogma (CH 17)
1/22 Regulation (CH 18)
FYI-There will be an exam next week,
and one the following week. The one on chapters 12, 13 & 14 will be next
week and one the following week on 15, 16, 17, 18. I thought that one test on
12-18 was a bit much. This should catch us up on testing.
I will set it up as 30 minutes –review
(you can ask questions, but, I’m not leading a review), 60 minutes test (50 min
test 10 min data entry), 30 minutes new lecture material
Homework
Due 1/19-midnight
Mastering Chapter 18 (new due date)
Due 1/20- DNA
extraction questions (not really a lab)
DATE CHANGE Due
1/26 (I don’t have AP BIO on 1/23-so I’m giving you an extra weekend) Fruit Fly
Simulation (Can be/should be done in pairs/threes – no groups of 4 or larger)
It is a LONG assignment and requires
thought to do well-
https://drive.google.com/file/d/0B0r2l9_tFA_FWnd6YkRyWTM2d3M/view?usp=sharing
Virtual Fly
Site: http://www.sciencecourseware.org/vcise/drosophila/
Due 1/26 FRQ: An organism is heterozygous at two genetic
loci on different chromosomes.
| |
| |
| |
--| --|
| |
| |
--| --|
| |
a)
Explain how these alleles are transmitted by the process of mitosis to
daughter cells.
b)
Explain how these alleles are distributed by the process of meiosis to
gametes.
c)
Explain how the behavior of these two pairs of homologous chromosomes
during meiosis provides the physical basis for Mendel's two laws of
inheritance.
Labeled diagrams that are explained in
your answer may be useful.
Due 1/28 FRQ: Experiments
by the following scientists provided critical information concerning DNA.
Describe each classical experiment and indicate how it provided evidence for
the chemical nature of the gene.
a. Hershey and Chase - bacteriophage replication
b. Griffith and Avery - bacterial transformation
c. Meselson and Stahl - DNA replication in
bacteria
Agenda and Homework updated 1/10
1/12: Χ2 , Genetic
Diseases; DNA
1/13 Start “better” Do plants need
light to germinate? Labs; DNA
1/15 DNA Extraction; DNA; Central
Dogma
Homework
Due 1/12:
Design for a “better” lab on light and plant germination (group)
Due
1/8-midnight Mastering Chapter 15, 16
Due
1/11-midnight Mastering Chapter 17
Due 1/19-midnight
Mastering Chapter 18 (new due date)
OOPS-I lost
count in numbering the masteringbiology assignments-BUT-
13-Meiosis,
14-Mendel, 15-chromosomal and molecular biology will be/are in gradebook for
the second nine weeks
There is no
16 (oops)
17-Central
Dogma (due 1/11), 18-Gene Regulation (now due 1/19) will be in the 3rd 9 weeks
Due 1/20- DNA
extraction questions (not really a lab)
Due 1/23
Fruit Fly Simulation (Can be/should be done in pairs/threes – no groups of 4 or
larger) It is a LONG assignment and requires
thought to do well-
https://drive.google.com/file/d/0B0r2l9_tFA_FWnd6YkRyWTM2d3M/view?usp=sharing
Virtual Fly
Site: http://www.sciencecourseware.org/vcise/drosophila/
Soundbite debates: Due 3/12 (depending on block scheduling) Research and prepare “sound bites” for the DNA Technology Discussion Day (see handout-also in the shared folder) |
All late work etc. must be submitted by Wednesday 1/13 to be considered for the report card
Agenda and Homework updated 12/20
1/5 Chromosomal Abnormalities (CH 15); start do plants need
light to germinate
1/6 Molecular Basis for Genetics – DNA (CH 16)
1/8 Razors Edge
1/9 DNA; DNA-extraction; check do plants need light to
germinate
Homework
Due 1/4 11:59
PM Mastering Biology 14-Mendel (2 hours)
Due 1/5
Crosses-Mono Hybrid & Dihybrid simulation report w/Chi square calculations
WITH the addition of sample Chi square “experiment”
update 12/24-The Fruit Fly Simulation Site has been "down" since 12/23. If it is permanently dead the assignment will have to be replaced. Sorry.
Due 1/5 Fruit
Fly Simulation (Can be/should be done in pairs/threes – no groups of 4 or
larger) It is a LONG assignment and requires
thought to do well-
https://drive.google.com/file/d/0B0r2l9_tFA_FWnd6YkRyWTM2d3M/view?usp=sharing
Virtual Fly
Site: http://www.sciencecourseware.org/vcise/drosophila/
On the Razors Edge (1/8/2015) Biology textbooks are out of date before they are printed. You will report to the class on a
discovery, development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The assignment has two parts, and you will get a grade for both parts.
Part A is due by 12/16 or it will
be graded as late. (A) You
will find something you want to talk about and you will email a 1 paragraph
description of the discovery, development or theory, along with appropriate
citations. No two students in the same
class can do the same something, so it will be first come first
registered. It MUST be something that
I can’t find in your or any other introductory biology textbook.
Additionally, it cannot simply be something so advanced it isn’t in your
textbook. It has to be something new, something on the “razors edge” of biology.
(B) You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to answer
questions about the discovery, development or theory. |
Due 1/12:
Mini-Lab: Do mung beans need light to germinate?
Due 1/12:
Design for a “better” lab on light and plant germination (group)
Due
1/8-midnight Mastering Chapter 15, 16 (90 min)
Due
1/11-midnight Mastering Chapter 17 (90 min)
Due
1/15-midnight Mastering Chapter 18 (60 min)
Chi Square | |||
Mono Hybrid Cross | |||
Genotypes | Spoon-Spoon | 113 | |
Spoon-Spork | 222 | ||
Spork-Spork | 101 | ||
Dihybrid Cross | |||
Phenotype | Dominant-Dominant | 347 | |
Dominant-Recessive | 133 | ||
Recessive-Dominant | 138 | ||
Recessive-Recessive | 77 | ||
M&Ms | Random Distribution | Mars Co. Website | Actual Counts |
Brown | 16.67% | 13% | 481 |
Yellow | 16.67% | 14% | 210 |
Red | 16.67% | 13% | 216 |
Green | 16.67% | 16% | 525 |
Blue | 16.67% | 24% | 282 |
Orange | 16.67% | 20% | 424 |
Agenda and Homework updated 12/13
12/16 – Mendelian Genetics; Crosses-simulation; Fruit Fly
Lab
12/18 – Genetics; Chi square
Homework
Due 12/15
11:59 PM Mastering Biology 13-Meiosis (1 hour)
Due 12/16:
Extra Credit: 3-Click and Learns from HHMI (related to last year’s Holiday
Lectures) Do All 3 (links below): For p53-fill in the worksheet (Hard Copy) For
BCR & Cell Cycle make your own worksheet (with answers)-ONLY electronic
copies accepted in editable formats The
better your worksheets the more extra credit.
You HAVE to do all 3 to get credit
http://www.hhmi.org/biointeractive/p53-gene-and-cancer
http://www.hhmi.org/biointeractive/bcr-abl-cancer-protein-structure-function
http://www.hhmi.org/biointeractive/eukaryotic-cell-cycle-and-cancer
Due 12/16: Extended
essay (not FRQ): Although cancer is not one disease, most cancers share certain
features. Using the information from the packet, Cell Biology and Cancer,
explain how cancer is a disease of the cell cycle and the implications of that
statement. You can also include
information from the Click and Learns (see above)
Due 12/18
Crosses-Mono Hybrid & Diybrid simulation report w/o Chi square calculations
Due 1/4 11:59
PM Mastering Biology 14-Mendel (2 hours)
Due 1/5
Crosses-Mono Hybrid & Dihybrid simulation report w/Chi square calculations
WITH the addition of sample Chi square “experiment”
Due 1/5 Fruit
Fly Simulation (Can be/should be done in pairs/threes – no groups of 4 or
larger) It is a LONG assignment and requires
thought to do well-
https://drive.google.com/file/d/0B0r2l9_tFA_FWnd6YkRyWTM2d3M/view?usp=sharing
Virtual Fly
Site: http://www.sciencecourseware.org/vcise/drosophila/
On the Razors Edge (1/8/2015) Biology textbooks are out of date before they are printed. You will report to the class on a
discovery, development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The assignment has two parts, and you will get a grade for both
parts. Part A is due by 12/16 or
it will be graded as late. (A) You
will find something you want to talk about and you will email a 1 paragraph
description of the discovery, development or theory, along with appropriate
citations. No two students in the same
class can do the same something, so it will be first come first
registered. It MUST be something that
I can’t find in your or any other introductory biology textbook.
Additionally, it cannot simply be something so advanced it isn’t in your
textbook. It has to be something new, something on the “razors edge” of
biology. (B) You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to answer
questions about the discovery, development or theory. |
Monday Dec 8 2-4-6
Tuesday Dec 9 1-3-5 Wednesday Dec 10 2-4-6 Thursday Dec 11 1-3-5 Early Release Friday Dec 12 2-4-6 Monday Dec 15 1-3-5 Tuesday Dec 16 2-4-6 Wednesday Dec 17 1-3-5 Thursday Dec 18 2-4-6 Friday Dec 19 1-3-5 |
Agenda and Homework updated 12/5
12/8 – Cell
Cycle; Mitosis slides;
12/10 – Cell Cycle/Meiosis
12/12 – Meiosis/Chromosomal Diseases/Pedigrees
12/16 – Mendelian Genetics; Crosses-simulation; Fruit Fly
Lab
12/18 – Genetics; Chi square
Homework
Due 12/7
11:59 PM Mastering Biology 12- Cell Cycle (60 min)
Due 12/12
OnLine Mitosis – 2 parts Arizona & Dr. G. (can be in groups up to 3)
http://mdgottfried.cwahi.net/Forms/AP/AP-Mitosis.html
http://mdgottfried.cwahi.net/Forms/AP/onioncellmitosis/MitosisLab.html
Due 12/15
11:59 PM Mastering Biology 13-Meiosis (1 hour)
Due 12/16:
Extra Credit: 3-Click and Learns from HHMI (related to last year’s Holiday
Lectures) Do All 3 (links below): For p53-fill in the worksheet (Hard Copy) For
BCR & Cell Cycle make your own worksheet (with answers)-ONLY electronic
copies accepted in editable formats The
better your worksheets the more extra credit.
You HAVE to do all 3 to get credit
http://www.hhmi.org/biointeractive/p53-gene-and-cancer
http://www.hhmi.org/biointeractive/bcr-abl-cancer-protein-structure-function
http://www.hhmi.org/biointeractive/eukaryotic-cell-cycle-and-cancer
Due 12/16: Extended
essay (not FRQ): Although cancer is not one disease, most cancers share certain
features. Using the information from the packet, Cell Biology and Cancer,
explain how cancer is a disease of the cell cycle and the implications of that
statement. You can also include
information from the Click and Learns (see above)
Due 12/18
Crosses-Mono Hybrid & Diybrid simulation report w/o Chi square calculations
Due 1/4 11:59
PM Mastering Biology 14-Mendel (2 hours)
Due 1/5
Crosses-Mono Hybrid & Dihybrid simulation report w/Chi square calculations
WITH the addition of sample Chi square “experiment”
Due 1/5 Fruit
Fly Simulation (Can be/should be done in pairs/threes – no groups of 4 or
larger) It is a LONG assignment and requires
thought to do well-
On the Razors Edge (1/8/2015) Biology textbooks are out of date before they are
printed. You will report to the class on
a discovery, development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The assignment has two parts, and you will get a grade for
both parts. Part A is due by 12/16
or it will be graded as late. (A) You
will find something you want to talk about and you will email a 1 paragraph
description of the discovery, development or theory, along with appropriate
citations. No two students in the same
class can do the same something, so it will be first come first
registered. It MUST be something that I
can’t find in your or any other introductory biology textbook. Additionally, it
cannot simply be something so advanced it isn’t in your textbook. It has to be
something new, something on the “razors edge” of biology. (B) You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to answer
questions about the discovery, development or theory. |
Monday Dec 1 1-3-5 Tuesday Dec 2 2-4-6 Wednesday Dec 3 1-3-5 Thursday Dec 4 2-4-6 Friday Dec 5 1-3-5 Monday Dec 8 2-4-6 Tuesday Dec 9 1-3-5 Wednesday Dec 10 2-4-6 Thursday Dec 11 1-3-5 Early Release Friday Dec 12 2-4-6 |
Agenda and Homework updated 11/27
12/2 Energetics
Review
12/4 EXAM; 50 MC & FRQ-data interpretation
12/8 – Cell
Cycle; Mitosis slides;
Homework
Due 12/7
11:59 PM Mastering Biology 12- Cell Cycle (60 min)
Due 12/12
OnLine Mitosis – 2 parts Arizona & Dr. G. (can be in groups up to 3)
http://mdgottfried.cwahi.net/Forms/AP/AP-Mitosis.html
http://mdgottfried.cwahi.net/Forms/AP/onioncellmitosis/MitosisLab.html
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. |
Tuesday Nov 25
1-3-5
Wednesday Nov 26
2-4-6 Thursday
Nov
27 No School , No testing Friday
Nov 28 No school , No
testing Tuesday
Dec 2
2-4-6 Wednesday Dec 3
1-3-5 Thursday Dec 4
2-4-6
Friday
Dec 5
1-3-5 Tuesday Dec 9
1-3-5
Wednesday Dec 10
2-4-6 Thursday
Dec
11 1-3-5 Early Release
Monday Dec 1 1-3-5
Monday Dec 8 2-4-6
Agenda and Homework updated 11/21
11/24 Photosynthesis
11/26 Energetics Review; Burning Nut Lab
Homework
Due 11/24
Photosynthesis LAB- Two parts – Stapled together into a packet
Part A- Group
(Title/Hypothesis/Procedure/Data (raw & graphs)
Part
B-Individual (Analysis and Conclusion)
Due 11/24
Photosynthesis Box Model
Due 11/24
HHMI-Lecture Reviews (6 paragraphs)
Due 12/2
Respiration lab calculations
There will be
an exam on Respiration and Photosynthesis 12/4
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. |
HHMI Festival information can be found on the main index page http://mdgottfried.net
Agenda and
Homework updated 11/14
FYI- I will be
caught up entering
grades on Sunday 11/16
11/18 Respiration Control;
Photosynthesis Box Model; Lab
design
11/20 Photosynthesis Lab
11/21 Field Trip
Homework
Due 11/18
Experimental
Design for “big” lab
NO MASTERING
DUE THIS WEEK Due 11/20 Study the poster on the Holiday
Lectures HHMI-Biodiversity
in the Age of Humans
http://www.hhmi.org/biointeractive/poster-anthropocene-human-impact-environment
For at least
6 of the text boxes provide a summary in your own words.
For at least
2 of the text boxes do additional research and provide additional
annotation
Due 11/24
Photosynthesis LAB-
Two parts – Stapled
together into a packet
Part A- Group
(Title/Hypothesis/Procedure/Data (raw & graphs)
Part
B-Individual (Analysis and Conclusion)
Due 11/24
Photosynthesis Box Model
Due 11/24
HHMI-Lecture Reviews (6 paragraphs)
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. (A)
You
will find something you want to talk about and you will email a 1
paragraph description of the discovery, development or theory, along
with appropriate citations. No
two students in the same class can do the same something, so it will be
first come first registered. It
MUST be something that I can’t find in your or any other introductory
biology textbook. Additionally, it cannot simply be something so
advanced it isn’t in your textbook. It has to be something new,
something on the “razors edge” of biology. (B)
You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to
answer questions about the discovery, development or theory. |
Monday Nov
17
1-3-5 Tuesday Nov 18
2-4-6 Wednesday Nov 19
1-3-5 Thursday Nov 20
2-4-6 Friday
Nov
21 1-3-5 Tuesday Nov 25
1-3-5
Wednesday Nov 26
2-4-6 Thursday
Nov
27 No School , No testing Friday
Nov 28 No school , No
testing Tuesday
Dec 2
2-4-6 Wednesday Dec 3
1-3-5 Thursday Dec 4
2-4-6
Friday
Dec 5
1-3-5 Tuesday Dec 9
1-3-5
Wednesday Dec 10
2-4-6 Thursday
Dec
11 1-3-5 Early Release
Monday Nov 24 2-4-6
Monday Dec 1 1-3-5
Monday Dec 8 2-4-6
FYI- I will be
caught up entering
grades on Sunday 11/9
11/10 Respiration
11/13 Respiration Stages….box model
11/14 Photosynthesis (meet the
assay-design a “big” lab)
Homework
Due 11/10
Respiration Lab
Due 11/14
(11:59 PM) Mastering Biology 11-Photosynthesis (LONG 90 minutes)
Due 11/14 Box
model of respiration
Due 11/17 (?)
Photosynthesis Lab – 1; Experimental Design for “big” lab
NO MASTERING
DUE THIS WEEK Due 11/20 Study the poster on the Holiday
Lectures HHMI-Biodiversity
in the Age of Humans
http://www.hhmi.org/biointeractive/poster-anthropocene-human-impact-environment
For at least
6 of the text boxes provide a summary in your own words.
For at least 2 of the text boxes do additional research and provide additional annotation
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. (A)
You
will find something you want to talk about and you will email a 1
paragraph description of the discovery, development or theory, along
with appropriate citations. No
two students in the same class can do the same something, so it will be
first come first registered. It
MUST be something that I can’t find in your or any other introductory
biology textbook. Additionally, it cannot simply be something so
advanced it isn’t in your textbook. It has to be something new,
something on the “razors edge” of biology. (B)
You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to
answer questions about the discovery, development or theory. |
Monday Nov
17
1-3-5 Tuesday Nov 18
2-4-6 Wednesday Nov 19
1-3-5 Thursday Nov 20
2-4-6 Friday
Nov
21 1-3-5
Tuesday Nov 25
1-3-5
Wednesday Nov 26
2-4-6 Thursday
Nov
27 No School , No testing Friday
Nov 28 No school , No
testing
Tuesday
Dec 2
2-4-6 Wednesday Dec 3
1-3-5 Thursday Dec 4
2-4-6
Friday
Dec 5
1-3-5
Tuesday Dec 9
1-3-5
Wednesday Dec 10
2-4-6 Thursday
Dec
11 1-3-5 Early Release Friday
Dec
12 2-4-6 |
Thursday
afterschool?
Agenda
and Homework updated 10/31
FYI- I will be
caught up entering
grades on Sunday 11/2
Monday 11/3 Exam
(40 questions Chapters 6-8)
Tuesday 11/4-Election Day – No school
11/6 – Respiration Lab
11/7- Respiration
Homework
Due
11/3
Catalase Lab (explain what you did, what your results were
(at
least 2 different rates of oxygen production) and what happened and why.
Due 11/5
(11:59 PM) Mastering Biology 10-Respiration (LONG 90-120 minutes)
Due 11/10
Respiration Lab
Due 11/14
(11:59 PM) Mastering Biology 11-Photosynthesis (LONG 90 minutes)
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. (A)
You
will find something you want to talk about and you will email a 1
paragraph description of the discovery, development or theory, along
with appropriate citations. No
two students in the same class can do the same something, so it will be
first come first registered. It
MUST be something that I can’t find in your or any other introductory
biology textbook. Additionally, it cannot simply be something so
advanced it isn’t in your textbook. It has to be something new,
something on the “razors edge” of biology. (B)
You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to
answer questions about the discovery, development or theory. |
DATA: OSMOSIS
LAB
LABEL |
% change in mass |
-13.3% |
|
PERIOD 2 Station2
-A |
-18.9% |
PERIOD 2 Station3
-A |
-14.7% |
PERIOD 2 Station4
-A |
-15.1% |
PERIOD 2 Station5
-A |
-16.1% |
PERIOD 2 Station6 -A |
-13.6% |
PERIOD 4 Station1
-A |
-14.7% |
PERIOD 4 Station2
-A |
-19.0% |
PERIOD 4 Station3
-A |
-16.2% |
PERIOD 4 Station4
-A |
-13.7% |
PERIOD 4 Station5
-A |
-13.8% |
PERIOD 4 Station6
-A |
-15.3% |
PERIOD 6 Station1
-A |
-4.7% |
PERIOD 6 Station2
-A |
-20.3% |
PERIOD 6 Station3
-A |
-15.1% |
PERIOD 6 Station4
-A |
-19.0% |
PERIOD 6 Station5
-A |
-15.3% |
PERIOD 6 Station6
-A |
-20.6% |
PERIOD 2 Station1
-B |
1.2% |
PERIOD 2 Station2
-B |
4.6% |
PERIOD 2 Station3
-B |
2.5% |
PERIOD 2 Station4
-B |
-0.7% |
PERIOD 2 Station5
-B |
0.2% |
PERIOD 2 Station6
-B |
1.1% |
PERIOD 4 Station1
-B |
1.4% |
PERIOD 4 Station2
-B |
1.6% |
PERIOD 4 Station3
-B |
-4.0% |
PERIOD 4 Station4
-B |
-6.4% |
PERIOD 4 Station5
-B |
3.0% |
PERIOD 4 Station6
-B |
1.5% |
PERIOD 6 Station1
-B |
9.7% |
PERIOD 6 Station2
-B |
2.7% |
PERIOD 6 Station3
-B |
0.6% |
PERIOD 6 Station4
-B |
-0.3% |
PERIOD 6 Station5
-B |
2.1% |
PERIOD 6 Station6
-B |
2.0% |
PERIOD 2 Station1 -C |
10.4% |
PERIOD 2 Station2
-C |
11.5% |
PERIOD 2 Station3
-C |
12.5% |
PERIOD 2 Station4
-C |
10.7% |
PERIOD 2 Station5
-C |
10.3% |
PERIOD 2 Station6
-C |
12.9% |
PERIOD 4 Station1
-C |
10.4% |
PERIOD 4 Station2
-C |
12.6% |
PERIOD 4 Station3
-C |
7.9% |
PERIOD 4 Station4
-C |
7.1% |
PERIOD 4 Station5
-C |
13.4% |
PERIOD 4 Station6
-C |
12.4% |
PERIOD 6 Station1
-C |
16.7% |
PERIOD 6 Station2
-C |
12.2% |
PERIOD 6 Station3
-C |
10.7% |
PERIOD 6 Station4
-C |
11.6% |
PERIOD 6 Station5
-C |
16.0% |
PERIOD 6 Station6
-C |
16.1% |
FYI-
We will be on “regular” schedule
(M,T, F- 1-6; W-1,3,5;
Th-2,4,6) until at least mid-November
Monday 10/27 Enzymes
Tuesday 10/28 Enzymes
Thursday 10/30 Catalase lab
Friday 10/31 Exam (40
questions Chapters 6-8)
Homework
Due 10/27
(28) Osmosis Lab
Due 11/3
Catalase Lab
Due 11/5
(11:59 PM) Mastering Biology 10-Respiration (LONG 90-120 minutes)
On the
Razors Edge (1/8/2015) Biology
textbooks are out of date before they are printed.
You will report to the class on a discovery,
development or theory in biology that is so new it is not yet in
textbooks or common knowledge. The
assignment has two parts, and you will get a grade for both parts. Part
A is due by 12/15 or it will be graded as late. (A)
You
will find something you want to talk about and you will email a 1
paragraph description of the discovery, development or theory, along
with appropriate citations. No
two students in the same class can do the same something, so it will be
first come first registered. It
MUST be something that I can’t find in your or any other introductory
biology textbook. Additionally, it cannot simply be something so
advanced it isn’t in your textbook. It has to be something new,
something on the “razors edge” of biology. (B)
You
will present 2 minutes on Thursday 1/8/2015 and will be prepared to
answer questions about the discovery, development or theory. |
Agenda and Homework updated 10/18
FYI- Monday Oct.
20 1 thru 6 Tuesday Oct. 21 1
thru 6 Wednesday Oct.
22 1-3-5 Thursday Oct. 23 2-4-6 Monday Oct
27 1-3-5 Tuesday Oct
28 2-4-6 Wednesday Oct 29 1-3-5 Thursday Oct 30 2-4-6 Friday Oct 31 1-3-5 Monday
Nov 3 2-4-6 Tuesday Nov
4 Teacher Workday Wednesday Nov 5 1-3-5 Thursday Nov
6 2-4-6 Friday Nov 7th
1-3-5 Monday Nov
10 2-4-6 Tuesday Nov
11 Holiday Wednesday Nov 12 1-3-5 Thursday Nov 13 2-4-6 Friday Nov 14 1-3-5 |
10/20 Cells;
Enzymes
10/21
Enzymes; Membranes
10/23 Osmosis
lab
10/24-Teacher
Planning Day
Homework
Due 10/20
Enzyme Kinetics Packet (individual!!!!)
Due 10/28 (I
think) Osmosis Lab
Due 10/24
Mastering Biology 09 Metabolism (Chapter 8) ~45 minutes
SAT-Biology
Practice Tests???? Do you want me to sign up the class to
take practice questions for the SAT-Biology exam?
FYI
10/13 1-3-5
10/14 2-4-6
10/15 1-3-5 (PSAT)
10/16 2-4-6
10/17 1-3-5
Agenda
and Homework updated 10/11
10/13 Monday afterschool test review
2:30-3:30
Tuesday, October 14th
2-4-6 College Fair; Enzyme
Kinetics; Notetaking; Studying
Thursday , October 16th
2-4-6 On the
Shoulders of Giants
Homework
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations –Last grade first
marking
period
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
HHMI
Lectures- Friday 11/21 – chaperons
Due 10/14
Cell Drawings (annotated)
Due 10/17
Mastering Biology 08 Membranes (first grade new marking period)
Due 10/20
Enzyme Kinetics Packet (individual!!!!)
Population
Education Video Contest www.Worldof7Billion.org
FYI
10/6
2-4-6
10/7 1-3-5
10/8 2-4-6
10/9 1-3-5
(Early release)
10/10 2-4-6
10/13 1-3-5
10/14 2-4-6
10/15 1-3-5 (PSAT)
10/16 2-4-6
10/17 1-3-5
Agenda and
Homework updated 10/4
Monday, October
6th
2-4-6 Biochemistry Wrap Up
Wednesday, October 8th
2-4-6 EXAM Chapters 2-5
Friday, October
10th 2-4-6 Cells/Paperclipase
Tuesday, October 14th
2-4-6 Osmosis; Onion
Skin
Thursday , October 16th
2-4-6 On the
Shoulders of Giants
Homework
Due 10/14
Cell Drawings (annotated)
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations –Last grade first
marking
period
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
10/9- Test(65):
Chapters 2(8), 3(8), 4(14) & 5(35); 2 frqs
Due 10/17
Mastering Biology 08 Membranes (first grade 2nd marking period)
Agenda
and Homework updated 9/26
9/29 Carbon;
Carbohydrates; Lipids Biochemistry
9/30 Proteins,
Nucleic Acid; Biochemistry
10/2
Models-Biochemistry
10/3
Models-Biochemistry
Homework
Due 9/29:
(Mercy)-Pattern
Matching II
Due 9/29: Fat
lab
By 9/29 you
should have read chapter 5
Videos: There
are videos for all of this both from Crash Course and Bozeman…
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
FYI-Open
House 9/30 5:00-8:00 – No you don’t get extra credit for bringing your
parents-but, they get to meet me! Class visits begin at 6:00PM
due 10/3
Mastering
Biology 07 Cells (75-90 min)
HHMI
Lectures- Friday 11/21 – chaperons
10/9- Test(65): Chapters 2(8), 3(8), 4(14) & 5(35); 2 frqs
Looking far forward due 10/17
Mastering Biology 08 Membranes
Da Fat Lab”
-or any more appropriate title of your choice-
Problem: What is the relationship, if
any, between the
degree of saturation and the melting point of a fat? Which fat will
melt first?
Hypothesis?
Procedure: AGIC
Background Data
Oil |
Saturated |
Poly unsaturated |
Mono unsaturated |
grape seed |
7% |
71% |
21% |
sesame seed |
14% |
43% |
43% |
Avocado |
13% |
11% |
76% |
rape seed |
7% |
29% |
64% |
Olive |
14% |
14% |
71% |
coconut |
86% |
7% |
7% |
Walnut |
14% |
64% |
21% |
Results-
Data Table – melt order
Conclusion ????
Show me you can think!!!
Which fat is which number tube?
Explain your claim
(Claim/Evidence/Reasoning)
Agenda
and Homework updated 9/19
9/22 Pattern
Matching Part II
9/23
Models/Biochemistry – Carbohydrate; Lipid structure; fat lab
9/26
Models/Biochemistry proteins; nucleic acids
Homework
Due 9/29: Fat
lab
Reading:
Chapters 2-4 – pace yourself
By 9/29 you
should have read chapter 5
Videos: There
are videos for all of this both from Crash Course and Bozeman…
Due 9/19
Mastering Biology05-Chemistry Review (90 minutes-this is long, and
covers 3
chapters, so, I’m giving you time-don’t wait until 9/18 at 9 PM to
start J)
Due 9/22
Water Mini-labs
Due 9/26
Pattern Matching II (groups)
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
Reminder-last
day I’m collecting – 9/24 Fee $10
FYI-Open
House 9/30 5:00-8:00 – No you don’t get extra credit for bringing your
parents-but, they get to meet me! Class visits begin at 6:00PM
Due 9/26
Mastering
Biology 06-Biochemistry (90 minutes)
Looking
forward Mastering Biology 07 Cells due 10/3 (75-90 min)
HHMI
Lectures- Friday 11/21 – chaperons - We need 4 parent chaperons for a
field trip 11/21 to the University of Miami to participate in the HHMI
holiday lectures on science
Agenda
and Homework updated 9/13
9/15 Water
9/16 Carbon
9/18 (Early
Release) Models/Water mini-lab
9/19 Pattern
Matching Part I; Start Part II
Homework
Reading:
Chapters 2-4 – pace yourself
Videos: There
are videos for all of this both from Crash Course and Bozeman…
Due 9/19
Mastering Biology05-Chemistry Review (90 minutes-this is long, and
covers 3
chapters, so, I’m giving you time-don’t wait until 9/18 at 9 PM to
start J)
Due 9/22
Water Mini-labs
Due 9/26
Pattern Matching (groups)
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
Reminder-Fee $10
FYI-
QuestBridge
FYI-Open
House 9/30 5:00-8:00 – No you don’t get extra credit for bringing your
parents-but, they get to meet me! Class visits begin at 6:00PM
Seniors-9/17
College Night-
Agenda
and Homework updated 9/6
9/8
TimeLine/Speciation
9/9
TimeLine/Review
9/11 EXAM
–Evolutionary Theory
9/12 [Out of
AP Biology Sequence…but, chemistry review: Carbon/water – chapters 2-4]
Homework
After the
exam...Reading:
Chapters 2-4 – pace yourself
Videos: There
are videos for all of this both from Crash Course and Bozeman…
Due 9/8: Peer
Review-CPR (7PM)
Due 9/8:
Hardy Weinberg Lab
Due 9/8:
Hardy Weinberg Simulation Lab (groups of 1-4; amount of work expected
does
depend on the number of people involved). This requires a great deal of
computer expertise…You have to allow an old Java applet to run… See the
handout for details.
due 9/9:
Mastering Biology 04-Origin of Species (30 min)
due 9/12;
Time lines (mostly done in class 9/8, 9/9…but
Due 9/19
Mastering Biology05-Chemistry Review (90 minutes-this is long, and
covers 3
chapters, so, I’m giving you time-don’t wait until 9/18 at 9 PM to
start J)
NB: There
will be a longer term research project each 9 weeks. One will be a
research
paper, one a debate, one I haven’t decided yet, and one short oral
presentations (w/o props).
DUE 10/16: On
the Shoulders of Giants – 5 minute presentations
You pick a biologist working either
today or in the past 20 years and prepare a 5 minute presentation on
their
work, their contributions and the scientific “path” that led to their
discoveries. Basically, what they did, and the “giants” their work
rests upon.
NO written component. NO overlap. You have to “register” your
scientist-first come
first served. So, first step, do a little research and pick a
biologist. Second
step, register “your” biologist. You can do this by email or in class.
Third,
do more research and prepare a 5 minute (NO LONGER) presentation
(yes-you can
use notecards, no-you can’t use PowerPoint etc. You are spending 5
minutes
discussing/talking about “your” scientist and his/her work.
Reminder-Fee collection starts 9/9
FYI-
QuestBridge
FYI-Open
House 9/30 5:30-8:00 – No you don’t get extra credit for bringing your
parents-but, they get to meet me! Class visits begin at 6:00PM
Hardy-Weinberg Data
8A-Tasting | Per 2 | Per 4 | Per 6 | total | |||||
Tasters | 14 | 18 | 11 | 43 | |||||
Non-Tasters | 8 | 6 | 7 | 21 | |||||
8B-Random | Per 2 | Per 4 | Per 6 | ||||||
AA | 10 | 19 | 13 | ||||||
Aa | 7 | 12 | 6 | ||||||
aa | 5 | 3 | 0 | ||||||
8C-Selection | Per 2 | Per 4 | Per 6 | ||||||
AA | 15 | 21 | 16 | ||||||
Aa | 7 | 3 | 2 | ||||||
aa | 0 | 0 | 0 | ||||||
8D-Heterozygote Advantage | Per 2 | Per 4 | Per 6 | ||||||
AA | 8 | 11 | 8 | ||||||
Aa | 14 | 13 | 10 | ||||||
aa | 0 | 0 | 0 | ||||||
8E-Drift | Groups | ||||||||
AA | 2 | 5 | 1 | 4 | 4 | 4 | 1 | 5 | 0 |
Aa | 4 | 2 | 5 | 4 | 3 | 4 | 4 | 1 | 3 |
aa | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 3 |
Agenda
and Homework
updated 8/29
9/2
Phylogenetics/Evolutionary
Theory
9/4 Hardy
Weinberg
Lab
9/5
Evolutionary
Theory
NB: There will be a test next week on Evolutionary Theory
Looking forward: Mastering Biology
04-Origin of Species (30 min) will be due 9/9
Homework
DO NOT WRITE
THE Fisherbeast
lab report until after class Tuesday
Due 9/2: CPR-Essay-Three major chemical bonds (7 PM)
http://cpr.molsci.ucla.edu/cpr/cpr/login.asp
Title:
Compare and contrast the three major chemical bonds important for
Biology Write
an essay of 250 to 320 words (minimum 220, max 500). In the essay,
compare and contrast the three major chemical bonds important for
biology. In the essay you should: • Start with a topic
sentence (a topic sentence is a sentence that addresses the whole topic
of the essay • Describe why atoms form
bonds (that's the comparison part) • Contrast the different
bonds in terms of how they form, what property of atoms makes them form
one kind rather than another, and how strong the different types of
bonds are • Define all the technical
terms you use • Provide examples when
appropriate. |
Due 9/2 Make a cladogram from a
character table – Handout
(you can work in pairs or alone)
Due 9/5 Mastering Biology 03-Natural
Selection (plan on an
hour!)
Due 9/5 Individual conclusions to the
Fisherbeast Simulation
Due 9/8: Peer Review-CPR (7PM)
Due 9/8: Hardy Weinberg Lab
Due 9/8: Hardy Weinberg Simulation
Lab (groups of 1-4;
amount of work expected does depend on the number of people involved).
This
requires a great deal of computer expertise…You have to allow an old
Java
applet to run…There is a handout!
Using the Hardy Weinberg Simulator at
http://www.bioservers.org/sim/
(1)
Think
of a research question related to the Hardy-Weinberg equilibrium and
evolution
and
(2)
Set
up a simulation to explore YOUR research question, then
(3)
Present
your data, and
(4)
Using
the Claim/Evidence/Reasoning Format, draw conclusions about the
simulated
population(s) and
(5)
Draw
general conclusions about the simulation process and the H-W
equilibrium
explaining,
(6)
What
does it all mean?
I have looked long and hard for
something that was easier to
use, but, had the same versatility to teach about populations. Follow the handout to
understand how to use
the program. THEN, use the simulation to illustrate as much about this
topic as
you can.
Reading for 03-Natural Selection:
22.2, 22.3, 23.1
There is a Quizlet vocabulary on
Natural Selection
There are Bozeman Videos
001-Natual Selection
003-Genetic Drift
004-Evidence for Evolution
Review-Natural Selection
Stickleback Evolution
Crash Course Biology 14:Natural
Selection
Reminder-Fee
collection starts 9/9
FYI- We will
be going
to a new bell schedule with only two lunches starting Tuesday 9/2
Updtated 8/25 CPR Log in information: http://cpr.molsci.ucla.edu/cpr/cpr/login.asp New user logging in Select Institution: North Miami Beach Sr HS Enter ID Number w/o leading zeros i.e. 0123456 = 123456 WRITE DOWN THE USER ID THAT IT TELLS YOU! Create password/challenge question Do introductory assignment by Friday |
Agenda
and Homework
updated 8/23
8/25 Time;
Data
analysis – Height Lab (stats); CPR Log in information
8/26 Darwin
8/28
Fisherbeast; CPR
Help
8/29
Phylogenetics; Fisherbeast
Homework
Summer Assignment Due
8/18-Letter (late after today, unless you are completely new to the
class, then due 8/22) Due
8/25-YIF (collected from server-7:00 AM) Due
8/25-Test 1 (mc) (collected from server-7:00 AM) Due
8/25-Chemistry optional work (collected from server-7:00 AM) |
Due 8/25: Mastering Biology:
00-Introduction (<15 minutes
+ reading time)
Due 8/25: Mastering Biology: 01-Life
(<15 minutes +
reading time)
Due 8/25 Seed Germination mini-lab
(in class/email by class
time)
Due 8/29 CPR Log on & Intro
completed
Due 8/29: Mastering Biology
02-Phylogenetics
Due 9/2: CPR-Essay-Three major
chemical bonds (7 PM)
Title:
Compare and contrast the three major chemical bonds important for
Biology Write
an essay of 250 to 320 words (minimum 220, max 500). In the essay,
compare and contrast the three major chemical bonds important for
biology. In the essay you should: • Start with a topic
sentence (a topic sentence is a sentence that addresses the whole topic
of the essay • Describe why atoms form
bonds (that's the comparison part) • Contrast the different
bonds in terms of how they form, what property of atoms makes them form
one kind rather than another, and how strong the different types of
bonds are • Define all the technical
terms you use • Provide examples when
appropriate. |
Due 9/2 Make a cladogram from a
character table – Handout (you
can work in pairs or alone)
Due 9/8: Peer Review-CPR (7PM)
For unit 02-Phylogenetics
Vocabulary – (Quizlet Vocabulary- http://quizlet.com/melindamalcore
)
By
chapter 25; by Big Idea 1.B;
Due by 8/29 Videos
Bozeman:
006-Phylogenetics
Crash Course: 17 Evolutionary
Development; 19 Taxomony
Pre-planning:
Due 9/5 Mastering Biology 03-Natural
Selection (plan on an
hour!)
Reading for 03-Natural Selection:
22.2, 22.3, 23.1
There is a Quizlet vocabulary on
Natural Selection
There are Bozeman Videos
001-Natual Selection
003-Genetic Drift
004-Evidence for Evolution
Review-Natural Selection
Stickleback Evolution
Crash Course Biology 14:Natural
Selection
Reminder-Fee
collection
starts 9/9
Geekiwood-FIU
9/27 http://www.geekigirl.org/#!geekiwood-2014/c1gqe
Seed Germination Data
You don't have to write a complete lab report, just show some data analysis, and then, based on the data make a claim, support it with evidence, and explain your reasoning.
You can/should also discuss why it is wrong/bad to compare periods 2 & 4 to period 6.
|
Agenda
and Homework
updated 8/13
8/18 Welcome; Logistics; (shared
folder); Mastering Biology;
Big Ideas; Science Practices; Unit Plan
8/20 Safety lecture; Seed
Germination; Introduction to
course
8/21 Books; Data analysis and
Interpretation (group process
skills); FRQ; white boarding; height lab
8/22 Seed Germination; Data analysis
and interpretation;
RQ/CER; CPR
Reading due
by Friday
(in Mastering Biology):
Text (9th
Ed): Chapter 1.2; Holtzclaw Review (in shared folder)
Due Monday:
Campbell (Mastering Biology): 25.1-25.4;
Holtzclaw Reviews (shared folder):
25.1-25.4
Due 8/29: Campbell:
26.1, 26.2, 26.3, 26.6, 27.1, 27.2; Holtzclaw Reviews:
26.1, 26.2, 26.3,
26.6, 27.1, 27.2
Campbell
Text
Correlation:
Highlighted Table of Contents-in the
shared folder
https://drive.google.com/file/d/0B0r2l9_tFA_FQnE0ZnpYS1k1Zm8/edit?usp=sharing
Video/Flip
Plan ?
General Videos - Mostly you
have to search in YouTube, it is too time consuming to put in
live links...
Bozeman Videos
1
- Models &
Representation
2 - Using Mathematics
3 - Scientific Questioning
4 - Data Collection
Strategies
5
- Analysis &
Evaluation of Evidence
6
- Scientific
Explanations & Theories
7
- Scales, Concepts
& Representations
Supplemental
AP
Biology Resources
IB
Biology Testing Words https://www.youtube.com/watch?v=HhXJ4Cm4ol4&app=desktop
(stolen from IB,
but, valuable)
Homework
MB-Follow up (adaptive learning
questions)
Penalty
for late work; Can be done ahead of time
CPR- http://cpr.molsci.ucla.edu/cpr/cpr/login.asp
Summer Assignment Due
8/18-Letter (late after today, unless you are completely new to the
class, then due 8/22) Due
8/25-YIF (collected from server-7:00 AM) Due
8/25-Test 1 (mc) (collected from server-7:00 AM) Due
8/25-Chemistry optional work (collected from server-7:00 AM) |
Due 8/22: Welcome letter/safety
contract
Due 8/22: Mastering Biology:
Introductory Assignment (<15
minutes + reading time)
Due 8/25: Mastering Biology:
00-Introduction (<15 minutes
+ reading time)
Due 8/25: Mastering Biology: 01-Life
(<15 minutes +
reading time)
Due 8/25 Seed Germination mini-lab
(in class/email by class
time)
Due 8/25: CPR-Essay-Three major
chemical bonds (7 PM)
Title:
Compare and contrast the three major chemical bonds important for
Biology Write
an essay of 250 to 320 words (minimum 220, max 500). In the essay,
compare and contrast the three major chemical bonds important for
biology. In the essay you should: • Start with a topic
sentence (a topic sentence is a sentence that addresses the whole topic
of the essay • Describe why atoms form
bonds (that's the comparison part) • Contrast the different
bonds in terms of how they form, what property of atoms makes them form
one kind rather than another, and how strong the different types of
bonds are • Define all the technical
terms you use • Provide examples when
appropriate. |
Due 8/29: Peer Review-CPR (7PM)
Due 8/29: Mastering Biology
02-Phylogenetics
For unit 02-Phylogenetics
Vocabulary – (Quizlet Vocabulary- http://quizlet.com/melindamalcore
)
By
chapter 25; by Big Idea 1.B;
Due by 8/29 Videos
Bozeman:
006-Phylogenetics
Crash Course: 17 Evolutionary
Development; 19 Taxomony
FYI-
Sign up for the CAP Lists
Due
to Dr. G's problem with names, he is trying something new. In
addition to taking everyone's pictures, please call 786-529-4286 by
8/22 for an “A”, 8/25 for a “B,” 8/26 a “C” (you get the drift)
and say your name, clearly, the way you want me to say it,
twice
(like a foreign language tape). |
Summer-1 (Summer Homework w/links)
Your Inner Fish - Web Form Link
Pre-testSummer-2 (Extension-optional)
Access to your text book is through the Mastering Biology site from Pearson It is so much more than a text book! The site is password protected and access is strictly controlled. If you would like to preview the book, the site etc. feel free to email me for the log in details. For obvious reasons, I can not post a sensitive password on the web. I already have the details for 2014-15 and can either email them to you, or, there is a handout-stop by 411.
Classroom
doors will be immediately locked.
No passes for any reason (bathroom, water etc).
Sit away from the door.
Students in the hall will be brought into the nearest classroom.
Students in open areas should report to the nearest secured area.
Students in bathroom facilities should report to the nearest secured
area.
Follow directions of emergency personnel and administrators.
ALL staff and students remain in LOCK DOWN until the ALL CLEAR
announcement is made.
Science Fees
$10
Fee/year
If you are taking 2 science classes, you have to pay in each one
separately.
If you do not pay, an obligation slip will be submitted, and in order
to graduate, leave the school etc, you will have to pay (clear your
obligations).
Humor-40+ ways to tell if you've been traumatized by AP Biology (these will be funnier as you survive the course)
What you need to learn for AP Bio (poem)